Annotations

Type Name Description Pathways
Gene Code
rbfA
Ortholog
N0.HOG0000839 30S ribosome-binding factor RbfA
KEGG gene
K02834 rbfA; ribosome-binding factor A
Gene Ontology
GO:1901360 organic cyclic compound metabolic process
Gene Ontology
GO:0090304 nucleic acid metabolic process
Gene Ontology
GO:0071840 cellular component organization or biogenesis
Gene Ontology
GO:0071704 organic substance metabolic process
Gene Ontology
GO:0051716 cellular response to stimulus
Gene Ontology
GO:0050896 response to stimulus
Gene Ontology
GO:0046483 heterocycle metabolic process
Gene Ontology
GO:0044877 protein-containing complex binding
Gene Ontology
GO:0044464 obsolete cell part
Gene Ontology
GO:0044444 obsolete cytoplasmic part
Gene Ontology
GO:0044424 obsolete intracellular part
Gene Ontology
GO:0044238 primary metabolic process
Gene Ontology
GO:0044237 cellular metabolic process
Gene Ontology
GO:0044085 cellular component biogenesis
Gene Ontology
GO:0043170 macromolecule metabolic process
Gene Ontology
GO:0043024 ribosomal small subunit binding
Gene Ontology
GO:0043021 ribonucleoprotein complex binding
Gene Ontology
GO:0042274 ribosomal small subunit biogenesis
Gene Ontology
GO:0042254 ribosome biogenesis
Gene Ontology
GO:0034660 ncRNA metabolic process
Gene Ontology
GO:0034641 cellular nitrogen compound metabolic process
Gene Ontology
GO:0034470 ncRNA processing
Gene Ontology
GO:0033554 cellular response to stress
Gene Ontology
GO:0030490 maturation of SSU-rRNA
Gene Ontology
GO:0022613 ribonucleoprotein complex biogenesis
Gene Ontology
GO:0016072 rRNA metabolic process
Gene Ontology
GO:0016070 RNA metabolic process
Gene Ontology
GO:0010467 gene expression
Gene Ontology
GO:0009987 cellular process
Gene Ontology
GO:0009628 response to abiotic stimulus
Gene Ontology
GO:0009409 response to cold
Gene Ontology
GO:0009266 response to temperature stimulus
Gene Ontology
GO:0008152 metabolic process
Gene Ontology
GO:0008150 biological_process
Gene Ontology
GO:0006974 cellular response to DNA damage stimulus
Gene Ontology
GO:0006950 response to stress
Gene Ontology
GO:0006807 nitrogen compound metabolic process
Gene Ontology
GO:0006725 cellular aromatic compound metabolic process
Gene Ontology
GO:0006396 RNA processing
Gene Ontology
GO:0006364 rRNA processing
Gene Ontology
GO:0006139 nucleobase-containing compound metabolic process
Gene Ontology
GO:0005829 cytosol
Gene Ontology
GO:0005737 cytoplasm
Gene Ontology
GO:0005623 obsolete cell
Gene Ontology
GO:0005622 intracellular anatomical structure
Gene Ontology
GO:0005575 cellular_component
Gene Ontology
GO:0005488 binding
Gene Ontology
GO:0003674 molecular_function
Eggnog Protein
EP:rbfA
Eggnog Ortholog
EO:1VA0P
Eggnog Description
ED:One of several proteins that assist in the late maturation steps of the functional core of the 30S ribosomal subunit. Associates with free 30S ribosomal subunits (but not with 30S subunits that are part of 70S ribosomes or polysomes). Required for efficient processing of 16S rRNA. May interact with the 5'-terminal helix region of 16S rRNA
Gene Product
30S ribosome-binding factor RbfA

Sequences

Nucleotide sequence (GC-content: 56.2 %):

ATGCCGAATAAGCAATTCCGGGTGGAACGGCTCGCGCAACAGATTCAGCGCGAAGTCGACGACATCCTCTTAAAGCGGGTCCGCGATCCCCGGGTCAACGGGGTAACGGTGACCGGCGTTGACGTAACGGGTGACCTGCAGCAAGCGACGATCTACTACACGATCCTGTCGAAGCTGGCTTCGGACGCCGAGAAAACCCAAACCGGGTTGGATAAGGCGACCGGGCTGGTGCGCAGCGAGCTGGGGAGCCGCCTGAATATTTTCAAGGCACCGGAAATTAAGTTTGTCCGCGACCCATCGATTGAATACGGGAGTCGCATTGACGAGCTTCTGAACGAGCTTCACAAAAATAACGAGCTCTAA

Protein sequence:

MPNKQFRVERLAQQIQREVDDILLKRVRDPRVNGVTVTGVDVTGDLQQATIYYTILSKLASDAEKTQTGLDKATGLVRSELGSRLNIFKAPEIKFVRDPSIEYGSRIDELLNELHKNNEL

GenBank Info

gene - rbfA
locus_tag - FAM19471-i1-1.1_000857
inference - COORDINATES: similar to AA sequence:RefSeq:WP_003685195.1
note - Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - 30S ribosome-binding factor RbfA
protein_id - extdb:FAM19471-i1-1.1_000857

Gene locus (click to toggle display options) expand

Located on scaffold FAM19471-i1-1_scf0012

Update range to 10000 bp

Cellular location expand

Responsible annotations:
SL-0229: GO:0005622 intracellular anatomical structure
SL-0086: GO:0005737 cytoplasm
SL-0091: GO:0005829 cytosol

FAM19471-i1-1.1_000856
FAM19471-i1-1.1_000858