Annotations

Type Name Description Pathways
KEGG reaction
R03005 ATP:nicotinamide-nucleotide adenylyltransferase; ATP + Nicotinate D-ribonucleotide <=> Diphosphate + Deamino-NAD+ kornec01100 kornec01240 kornec00760
KEGG reaction
R00137 ATP:nicotinamide-nucleotide adenylyltransferase; ATP + Nicotinamide D-ribonucleotide <=> Diphosphate + NAD+ kornec01100 kornec00760
KEGG gene
K09710 ybeB; ribosome-associated protein
KEGG gene
K00969 nadD; nicotinate-nucleotide adenylyltransferase [EC:2.7.7.18] kornec01100 kornec01240 kornec00760
Gene Product
GP:ribosome silencing factor
Gene Ontology
GO:2000113 negative regulation of cellular macromolecule biosynthetic process
Gene Ontology
GO:2000112 regulation of cellular macromolecule biosynthetic process
Gene Ontology
GO:0090071 negative regulation of ribosome biogenesis
Gene Ontology
GO:0090069 regulation of ribosome biogenesis
Gene Ontology
GO:0080090 regulation of primary metabolic process
Gene Ontology
GO:0065007 biological regulation
Gene Ontology
GO:0060255 regulation of macromolecule metabolic process
Gene Ontology
GO:0051248 negative regulation of protein metabolic process
Gene Ontology
GO:0051246 regulation of protein metabolic process
Gene Ontology
GO:0051172 negative regulation of nitrogen compound metabolic process
Gene Ontology
GO:0051171 regulation of nitrogen compound metabolic process
Gene Ontology
GO:0050794 regulation of cellular process
Gene Ontology
GO:0050789 regulation of biological process
Gene Ontology
GO:0048523 negative regulation of cellular process
Gene Ontology
GO:0048519 negative regulation of biological process
Gene Ontology
GO:0044877 protein-containing complex binding
Gene Ontology
GO:0044464 obsolete cell part
Gene Ontology
GO:0044444 obsolete cytoplasmic part
Gene Ontology
GO:0044424 obsolete intracellular part
Gene Ontology
GO:0044087 regulation of cellular component biogenesis
Gene Ontology
GO:0043023 ribosomal large subunit binding
Gene Ontology
GO:0043021 ribonucleoprotein complex binding
Gene Ontology
GO:0034249 negative regulation of cellular amide metabolic process
Gene Ontology
GO:0034248 regulation of cellular amide metabolic process
Gene Ontology
GO:0032269 negative regulation of cellular protein metabolic process
Gene Ontology
GO:0032268 regulation of cellular protein metabolic process
Gene Ontology
GO:0031327 negative regulation of cellular biosynthetic process
Gene Ontology
GO:0031326 regulation of cellular biosynthetic process
Gene Ontology
GO:0031324 negative regulation of cellular metabolic process
Gene Ontology
GO:0031323 regulation of cellular metabolic process
Gene Ontology
GO:0019222 regulation of metabolic process
Gene Ontology
GO:0017148 negative regulation of translation
Gene Ontology
GO:0010629 negative regulation of gene expression
Gene Ontology
GO:0010608 posttranscriptional regulation of gene expression
Gene Ontology
GO:0010605 negative regulation of macromolecule metabolic process
Gene Ontology
GO:0010558 negative regulation of macromolecule biosynthetic process
Gene Ontology
GO:0010556 regulation of macromolecule biosynthetic process
Gene Ontology
GO:0010468 regulation of gene expression
Gene Ontology
GO:0009892 negative regulation of metabolic process
Gene Ontology
GO:0009890 negative regulation of biosynthetic process
Gene Ontology
GO:0009889 regulation of biosynthetic process
Gene Ontology
GO:0008150 biological_process
Gene Ontology
GO:0006417 regulation of translation
Gene Ontology
GO:0005829 cytosol
Gene Ontology
GO:0005737 cytoplasm
Gene Ontology
GO:0005623 obsolete cell
Gene Ontology
GO:0005622 intracellular anatomical structure
Gene Ontology
GO:0005575 cellular_component
Gene Ontology
GO:0005488 binding
Gene Ontology
GO:0003674 molecular_function
Gene Code
GC:rsfS
Eggnog Protein
EP:rsfS
Eggnog Ortholog
EO:2IKZ3
Eggnog Description
ED:Functions as a ribosomal silencing factor. Interacts with ribosomal protein L14 (rplN)
EC Number
EC:2.7.7.18 nicotinate-nucleotide adenylyltransferase; deamido-NAD+ pyrophosphorylase; nicotinate mononucleotide adenylyltransferase; deamidonicotinamide adenine dinucleotide pyrophosphorylase; NaMN-ATase; nicotinic acid mononucleotide adenylyltransferase kornec01100 kornec00760

Occurs in the following pathway maps:

Pathway Description
kornec00760 Nicotinate and nicotinamide metabolism
kornec01100 Metabolic pathways
kornec01240 Biosynthesis of cofactors

Sequences

Nucleotide sequence (GC-content: 68.5 %):

TTGAGCGCAACGGAACAGGCCATCGAACTGGCGAGGACCGCCGCCCGCGCGGCAGCCGACAAGAAGGGCACCGAAATCCTCGCCCTGGACGTCTCGGAGAACCTCGCCCTCACCGACATCTTCCTCATCATCACCGCCGGCAATGAGCGTCAGGTCGGGGCGGTCGTCGACGCCGTCGACGAGGCGGCCCGCGAGGCCGGCGCGAAGGTGGTGCGCCGCGAGGGGGAGCGGGAGAACCGCTGGGTGCTGCTGGACTACAACGACATCATCGTCCACGTGCAGCAGCCCGAGGTGCGCCAGACCTACTCCCTGGAGAGGCTGTGGAAGGACTGCCCGGAGGTCGACCTCAAGCTTCCGGCGGTCTCCGACGAGGCTGCCCGGTGA

Protein sequence:

MSATEQAIELARTAARAAADKKGTEILALDVSENLALTDIFLIITAGNERQVGAVVDAVDEAAREAGAKVVRREGERENRWVLLDYNDIIVHVQQPEVRQTYSLERLWKDCPEVDLKLPAVSDEAAR

GenBank Info

gene - rsfS
locus_tag - FAM19038-p1-1.1_002655
inference - COORDINATES: similar to AA sequence:RefSeq:WP_015070067.1
note - Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - ribosome silencing factor
protein_id - extdb:FAM19038-p1-1.1_002655

Gene locus (click to toggle display options) expand

Located on circular contig FAM19038-p1-1.1_scf1.

Update range to 10000 bp

Cellular location expand

Responsible annotations:
SL-0091: GO:0005829 cytosol
SL-0086: GO:0005737 cytoplasm
SL-0229: GO:0005622 intracellular anatomical structure

FAM19038-p1-1.1_002654
FAM19038-p1-1.1_002656