Annotations

Type Name Description Pathways
Gene Code
hrcA
Gene Product
heat-inducible transcriptional repressor HrcA
Ortholog
N0.HOG0000859 heat-inducible transcriptional repressor HrcA
KEGG gene
K03705 hrcA; heat-inducible transcriptional repressor
Gene Ontology
GO:2001141 regulation of RNA biosynthetic process
Gene Ontology
GO:2000113 negative regulation of cellular macromolecule biosynthetic process
Gene Ontology
GO:2000112 regulation of cellular macromolecule biosynthetic process
Gene Ontology
GO:1903507 negative regulation of nucleic acid-templated transcription
Gene Ontology
GO:1903506 regulation of nucleic acid-templated transcription
Gene Ontology
GO:1902679 negative regulation of RNA biosynthetic process
Gene Ontology
GO:0080090 regulation of primary metabolic process
Gene Ontology
GO:0071944 cell periphery
Gene Ontology
GO:0065007 biological regulation
Gene Ontology
GO:0060255 regulation of macromolecule metabolic process
Gene Ontology
GO:0051253 negative regulation of RNA metabolic process
Gene Ontology
GO:0051252 regulation of RNA metabolic process
Gene Ontology
GO:0051172 negative regulation of nitrogen compound metabolic process
Gene Ontology
GO:0051171 regulation of nitrogen compound metabolic process
Gene Ontology
GO:0050794 regulation of cellular process
Gene Ontology
GO:0050789 regulation of biological process
Gene Ontology
GO:0048523 negative regulation of cellular process
Gene Ontology
GO:0048519 negative regulation of biological process
Gene Ontology
GO:0045934 negative regulation of nucleobase-containing compound metabolic process
Gene Ontology
GO:0045892 negative regulation of transcription, DNA-templated
Gene Ontology
GO:0044464 obsolete cell part
Gene Ontology
GO:0031327 negative regulation of cellular biosynthetic process
Gene Ontology
GO:0031326 regulation of cellular biosynthetic process
Gene Ontology
GO:0031324 negative regulation of cellular metabolic process
Gene Ontology
GO:0031323 regulation of cellular metabolic process
Gene Ontology
GO:0019222 regulation of metabolic process
Gene Ontology
GO:0019219 regulation of nucleobase-containing compound metabolic process
Gene Ontology
GO:0016020 membrane
Gene Ontology
GO:0010629 negative regulation of gene expression
Gene Ontology
GO:0010605 negative regulation of macromolecule metabolic process
Gene Ontology
GO:0010558 negative regulation of macromolecule biosynthetic process
Gene Ontology
GO:0010556 regulation of macromolecule biosynthetic process
Gene Ontology
GO:0010468 regulation of gene expression
Gene Ontology
GO:0009892 negative regulation of metabolic process
Gene Ontology
GO:0009890 negative regulation of biosynthetic process
Gene Ontology
GO:0009889 regulation of biosynthetic process
Gene Ontology
GO:0008150 biological_process
Gene Ontology
GO:0006355 regulation of transcription, DNA-templated
Gene Ontology
GO:0005886 plasma membrane
Gene Ontology
GO:0005623 obsolete cell
Gene Ontology
GO:0005575 cellular_component
Eggnog Protein
EP:hrcA
Eggnog Ortholog
EO:2GKF5
Eggnog Description
ED:Negative regulator of class I heat shock genes (grpE- dnaK-dnaJ and groELS operons). Prevents heat-shock induction of these operons

Sequences

Nucleotide sequence (GC-content: 68.0 %):

GTGCTCGACGATCGCAAACTCGACGTGCTCAAGGCCATCGTCACCGACTACGTCTCGAGCAGGGAGCCGGTGGGATCCAAGGCCTTGGTGGAGCGCCACGGCCTGCACGTCTCGCCGGCCACCGTGCGCAATGACATGGCCGCGCTGGAGGAGGAGGGCTACATCAGCCATCCGCACACCAGCGCCGGTCGGATCCCGACCGACAAGGGCTACCGGCTCTTCGTCGACCGGATCGCCACCGTCAAACCCCTCTCGGGTCCCGAACGACGCGCGATCGCGAGCTTCATGAACGGCGCGGTCGACATCGACGACATCGTCACCCGCACGGTGAGGCTGCTGGCCCAGATCACCCATCAGGTGGCGATCATGCAGTACCCGGTGGCCTCCTCCTCGTCGATCCGACACCTGGAGCTGGTCGGACTGTCGGCCGACCGGGTGCTCATCGTCCTGATCACCTCCACCGGCGCCGTCGAGCAGCGCACCCTGGAGCTTCCCGGCCCCACCGAGGACCTGCTGGCCAGGCTGCGCAACCGTCTCAACCAGCTGCTGATCGGACGCACCCCGGCCGAGTCTGCCGACCTGCTGTCCGGATTCCTCGAGGAGTTCGACCCGACCACCCGGCCGATGGCCGCCAGCGTGACCGCCGGCGTCCTGGAGATCCTGTCCGCCGACCCGTCGGCACGGGTGCTGGTCTCCGGGGTGCCCAATCTCACCCGCTTCGGACCGACCCTGCACACCTCCATCCAGCCCGTTCTGGAGGCGCTGGAGGAGCAGGTCGTGCTGCTGCGCCTGCTCGGCGACGCCACCTCCGACGGTTCGGCAGGTCTGACCGTGCGGATCGGCTCCGAGAACTCCGACGAGAACTTCCAGTCGACCTCGGTCGTCGTGAGCACCTATGGTGACGACGGTGGCCGGTCGGGACTGGGCGTCGTCGGCCCCACCCTGATGGACTACCCCTCGACGATGGCCGCGGTCCGGGCGATCGCCCGGTATGTCGGCAGATTCCTGGCAGAAGGATGA

Protein sequence:

MLDDRKLDVLKAIVTDYVSSREPVGSKALVERHGLHVSPATVRNDMAALEEEGYISHPHTSAGRIPTDKGYRLFVDRIATVKPLSGPERRAIASFMNGAVDIDDIVTRTVRLLAQITHQVAIMQYPVASSSSIRHLELVGLSADRVLIVLITSTGAVEQRTLELPGPTEDLLARLRNRLNQLLIGRTPAESADLLSGFLEEFDPTTRPMAASVTAGVLEILSADPSARVLVSGVPNLTRFGPTLHTSIQPVLEALEEQVVLLRLLGDATSDGSAGLTVRIGSENSDENFQSTSVVVSTYGDDGGRSGLGVVGPTLMDYPSTMAAVRAIARYVGRFLAEG

GenBank Info

gene - hrcA
locus_tag - FAM19038-p1-1.1_002575
inference - COORDINATES: similar to AA sequence:RefSeq:WP_002519052.1
note - Derived by automated computational analysis using gene prediction method: Protein Homology.
codon_start - 1
transl_table - 11
product - heat-inducible transcriptional repressor HrcA
protein_id - extdb:FAM19038-p1-1.1_002575

Gene locus (click to toggle display options) expand

Located on scaffold FAM19038-p1-1_scf0001

Update range to 10000 bp

Cellular location expand

Responsible annotations:
SL-0162: GO:0016020 membrane
SL-0039: GO:0005886 plasma membrane

FAM19038-p1-1.1_002574
FAM19038-p1-1.1_002576